ID: 932439266

View in Genome Browser
Species Human (GRCh38)
Location 2:71721530-71721552
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439266_932439272 4 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439272 2:71721557-71721579 TCTTTCCCTCAGGGAACCCAAGG No data
932439266_932439282 23 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439282 2:71721576-71721598 AAGGTCAGGGAGAGGTGGCAGGG No data
932439266_932439278 18 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439266_932439277 15 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439277 2:71721568-71721590 GGGAACCCAAGGTCAGGGAGAGG No data
932439266_932439281 22 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439281 2:71721575-71721597 CAAGGTCAGGGAGAGGTGGCAGG No data
932439266_932439274 9 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439266_932439276 10 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439276 2:71721563-71721585 CCTCAGGGAACCCAAGGTCAGGG No data
932439266_932439269 -6 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439269 2:71721547-71721569 ACACTCCTTCTCTTTCCCTCAGG No data
932439266_932439270 -5 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439266 Original CRISPR GAGTGTGGACATCCAGTCCT GGG (reversed) Intergenic