ID: 932439267

View in Genome Browser
Species Human (GRCh38)
Location 2:71721531-71721553
Sequence GGAGTGTGGACATCCAGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439267_932439269 -7 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439269 2:71721547-71721569 ACACTCCTTCTCTTTCCCTCAGG No data
932439267_932439272 3 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439272 2:71721557-71721579 TCTTTCCCTCAGGGAACCCAAGG No data
932439267_932439282 22 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439282 2:71721576-71721598 AAGGTCAGGGAGAGGTGGCAGGG No data
932439267_932439281 21 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439281 2:71721575-71721597 CAAGGTCAGGGAGAGGTGGCAGG No data
932439267_932439270 -6 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439267_932439278 17 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439267_932439276 9 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439276 2:71721563-71721585 CCTCAGGGAACCCAAGGTCAGGG No data
932439267_932439277 14 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439277 2:71721568-71721590 GGGAACCCAAGGTCAGGGAGAGG No data
932439267_932439274 8 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439267 Original CRISPR GGAGTGTGGACATCCAGTCC TGG (reversed) Intergenic