ID: 932439268

View in Genome Browser
Species Human (GRCh38)
Location 2:71721545-71721567
Sequence TGAGGGAAAGAGAAGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439268_932439278 3 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439268_932439274 -6 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439268_932439281 7 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439281 2:71721575-71721597 CAAGGTCAGGGAGAGGTGGCAGG No data
932439268_932439276 -5 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439276 2:71721563-71721585 CCTCAGGGAACCCAAGGTCAGGG No data
932439268_932439277 0 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439277 2:71721568-71721590 GGGAACCCAAGGTCAGGGAGAGG No data
932439268_932439284 21 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439284 2:71721589-71721611 GGTGGCAGGGCTTGTGTATTGGG No data
932439268_932439283 20 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439283 2:71721588-71721610 AGGTGGCAGGGCTTGTGTATTGG No data
932439268_932439282 8 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439282 2:71721576-71721598 AAGGTCAGGGAGAGGTGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439268 Original CRISPR TGAGGGAAAGAGAAGGAGTG TGG (reversed) Intergenic
No off target data available for this crispr