ID: 932439270

View in Genome Browser
Species Human (GRCh38)
Location 2:71721548-71721570
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439260_932439270 11 Left 932439260 2:71721514-71721536 CCCAACCCCAGGCATTCCCAGGA No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439266_932439270 -5 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439264_932439270 5 Left 932439264 2:71721520-71721542 CCCAGGCATTCCCAGGACTGGAT No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439267_932439270 -6 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439265_932439270 4 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439261_932439270 10 Left 932439261 2:71721515-71721537 CCAACCCCAGGCATTCCCAGGAC No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439263_932439270 6 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439256_932439270 30 Left 932439256 2:71721495-71721517 CCCAAAATAACTCAGCTCTCCCA No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data
932439257_932439270 29 Left 932439257 2:71721496-71721518 CCAAAATAACTCAGCTCTCCCAA No data
Right 932439270 2:71721548-71721570 CACTCCTTCTCTTTCCCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type