ID: 932439271

View in Genome Browser
Species Human (GRCh38)
Location 2:71721552-71721574
Sequence GGTTCCCTGAGGGAAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439271_932439286 27 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439286 2:71721602-71721624 GTGTATTGGGAAGAGTTGCTGGG No data
932439271_932439287 28 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439287 2:71721603-71721625 TGTATTGGGAAGAGTTGCTGGGG No data
932439271_932439283 13 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439283 2:71721588-71721610 AGGTGGCAGGGCTTGTGTATTGG No data
932439271_932439277 -7 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439277 2:71721568-71721590 GGGAACCCAAGGTCAGGGAGAGG No data
932439271_932439284 14 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439284 2:71721589-71721611 GGTGGCAGGGCTTGTGTATTGGG No data
932439271_932439285 26 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439285 2:71721601-71721623 TGTGTATTGGGAAGAGTTGCTGG No data
932439271_932439281 0 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439281 2:71721575-71721597 CAAGGTCAGGGAGAGGTGGCAGG No data
932439271_932439282 1 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439282 2:71721576-71721598 AAGGTCAGGGAGAGGTGGCAGGG No data
932439271_932439278 -4 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439271 Original CRISPR GGTTCCCTGAGGGAAAGAGA AGG (reversed) Intergenic