ID: 932439274

View in Genome Browser
Species Human (GRCh38)
Location 2:71721562-71721584
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439267_932439274 8 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439266_932439274 9 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439261_932439274 24 Left 932439261 2:71721515-71721537 CCAACCCCAGGCATTCCCAGGAC No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439260_932439274 25 Left 932439260 2:71721514-71721536 CCCAACCCCAGGCATTCCCAGGA No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439263_932439274 20 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439265_932439274 18 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439268_932439274 -6 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data
932439264_932439274 19 Left 932439264 2:71721520-71721542 CCCAGGCATTCCCAGGACTGGAT No data
Right 932439274 2:71721562-71721584 CCCTCAGGGAACCCAAGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type