ID: 932439278

View in Genome Browser
Species Human (GRCh38)
Location 2:71721571-71721593
Sequence AACCCAAGGTCAGGGAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932439263_932439278 29 Left 932439263 2:71721519-71721541 CCCCAGGCATTCCCAGGACTGGA No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439265_932439278 27 Left 932439265 2:71721521-71721543 CCAGGCATTCCCAGGACTGGATG No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439266_932439278 18 Left 932439266 2:71721530-71721552 CCCAGGACTGGATGTCCACACTC No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439264_932439278 28 Left 932439264 2:71721520-71721542 CCCAGGCATTCCCAGGACTGGAT No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439271_932439278 -4 Left 932439271 2:71721552-71721574 CCTTCTCTTTCCCTCAGGGAACC No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439267_932439278 17 Left 932439267 2:71721531-71721553 CCAGGACTGGATGTCCACACTCC No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data
932439268_932439278 3 Left 932439268 2:71721545-71721567 CCACACTCCTTCTCTTTCCCTCA No data
Right 932439278 2:71721571-71721593 AACCCAAGGTCAGGGAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932439278 Original CRISPR AACCCAAGGTCAGGGAGAGG TGG Intergenic