ID: 932440371

View in Genome Browser
Species Human (GRCh38)
Location 2:71731085-71731107
Sequence CCCGCAGGGGCGCCCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932440371_932440384 11 Left 932440371 2:71731085-71731107 CCGGCGCCGGGCGCCCCTGCGGG No data
Right 932440384 2:71731119-71731141 ATGTCGGGGTCCAGGCTCCTCGG No data
932440371_932440388 28 Left 932440371 2:71731085-71731107 CCGGCGCCGGGCGCCCCTGCGGG No data
Right 932440388 2:71731136-71731158 CCTCGGGTGACGATGACTTCAGG No data
932440371_932440385 12 Left 932440371 2:71731085-71731107 CCGGCGCCGGGCGCCCCTGCGGG No data
Right 932440385 2:71731120-71731142 TGTCGGGGTCCAGGCTCCTCGGG No data
932440371_932440379 -3 Left 932440371 2:71731085-71731107 CCGGCGCCGGGCGCCCCTGCGGG No data
Right 932440379 2:71731105-71731127 GGGACCCTTTTTCCATGTCGGGG No data
932440371_932440382 3 Left 932440371 2:71731085-71731107 CCGGCGCCGGGCGCCCCTGCGGG No data
Right 932440382 2:71731111-71731133 CTTTTTCCATGTCGGGGTCCAGG No data
932440371_932440389 29 Left 932440371 2:71731085-71731107 CCGGCGCCGGGCGCCCCTGCGGG No data
Right 932440389 2:71731137-71731159 CTCGGGTGACGATGACTTCAGGG No data
932440371_932440377 -5 Left 932440371 2:71731085-71731107 CCGGCGCCGGGCGCCCCTGCGGG No data
Right 932440377 2:71731103-71731125 GCGGGACCCTTTTTCCATGTCGG No data
932440371_932440378 -4 Left 932440371 2:71731085-71731107 CCGGCGCCGGGCGCCCCTGCGGG No data
Right 932440378 2:71731104-71731126 CGGGACCCTTTTTCCATGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932440371 Original CRISPR CCCGCAGGGGCGCCCGGCGC CGG (reversed) Intergenic
No off target data available for this crispr