ID: 932441667

View in Genome Browser
Species Human (GRCh38)
Location 2:71741182-71741204
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932441665_932441667 3 Left 932441665 2:71741156-71741178 CCATTTTCAAACATAGCGCATCA No data
Right 932441667 2:71741182-71741204 TGCTAGTTAAGTATCTTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr