ID: 932441686

View in Genome Browser
Species Human (GRCh38)
Location 2:71741308-71741330
Sequence CTTGATAATACTCCTTTTAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932441686_932441689 0 Left 932441686 2:71741308-71741330 CCGATAAAAGGAGTATTATCAAG No data
Right 932441689 2:71741331-71741353 TAGCTATCAATGTGGGCAACTGG No data
932441686_932441694 24 Left 932441686 2:71741308-71741330 CCGATAAAAGGAGTATTATCAAG No data
Right 932441694 2:71741355-71741377 GCTCCATCTATGGGAAACTATGG No data
932441686_932441691 2 Left 932441686 2:71741308-71741330 CCGATAAAAGGAGTATTATCAAG No data
Right 932441691 2:71741333-71741355 GCTATCAATGTGGGCAACTGGGG No data
932441686_932441693 15 Left 932441686 2:71741308-71741330 CCGATAAAAGGAGTATTATCAAG No data
Right 932441693 2:71741346-71741368 GCAACTGGGGCTCCATCTATGGG No data
932441686_932441690 1 Left 932441686 2:71741308-71741330 CCGATAAAAGGAGTATTATCAAG No data
Right 932441690 2:71741332-71741354 AGCTATCAATGTGGGCAACTGGG No data
932441686_932441688 -7 Left 932441686 2:71741308-71741330 CCGATAAAAGGAGTATTATCAAG No data
Right 932441688 2:71741324-71741346 TATCAAGTAGCTATCAATGTGGG No data
932441686_932441687 -8 Left 932441686 2:71741308-71741330 CCGATAAAAGGAGTATTATCAAG No data
Right 932441687 2:71741323-71741345 TTATCAAGTAGCTATCAATGTGG No data
932441686_932441692 14 Left 932441686 2:71741308-71741330 CCGATAAAAGGAGTATTATCAAG No data
Right 932441692 2:71741345-71741367 GGCAACTGGGGCTCCATCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932441686 Original CRISPR CTTGATAATACTCCTTTTAT CGG (reversed) Intergenic
No off target data available for this crispr