ID: 932442033

View in Genome Browser
Species Human (GRCh38)
Location 2:71743555-71743577
Sequence CTCAGGACCGTGCAAGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932442030_932442033 6 Left 932442030 2:71743526-71743548 CCGCTGTCAGAATGAGGTGGGGG No data
Right 932442033 2:71743555-71743577 CTCAGGACCGTGCAAGCCCATGG No data
932442023_932442033 28 Left 932442023 2:71743504-71743526 CCATTTCACAAACCTTCCAGGAC No data
Right 932442033 2:71743555-71743577 CTCAGGACCGTGCAAGCCCATGG No data
932442025_932442033 12 Left 932442025 2:71743520-71743542 CCAGGACCGCTGTCAGAATGAGG No data
Right 932442033 2:71743555-71743577 CTCAGGACCGTGCAAGCCCATGG No data
932442024_932442033 16 Left 932442024 2:71743516-71743538 CCTTCCAGGACCGCTGTCAGAAT No data
Right 932442033 2:71743555-71743577 CTCAGGACCGTGCAAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932442033 Original CRISPR CTCAGGACCGTGCAAGCCCA TGG Intergenic
No off target data available for this crispr