ID: 932444260

View in Genome Browser
Species Human (GRCh38)
Location 2:71764755-71764777
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932444257_932444260 10 Left 932444257 2:71764722-71764744 CCAGATCAAACGGACATAGAAAC No data
Right 932444260 2:71764755-71764777 CCACTCTCACTAGCCAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr