ID: 932448895

View in Genome Browser
Species Human (GRCh38)
Location 2:71797209-71797231
Sequence ACAAACAGTCAGAATCAAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932448895_932448897 6 Left 932448895 2:71797209-71797231 CCGGCTTGATTCTGACTGTTTGT No data
Right 932448897 2:71797238-71797260 CCTGCCTCAACATCCTGCCCTGG No data
932448895_932448898 7 Left 932448895 2:71797209-71797231 CCGGCTTGATTCTGACTGTTTGT No data
Right 932448898 2:71797239-71797261 CTGCCTCAACATCCTGCCCTGGG No data
932448895_932448901 20 Left 932448895 2:71797209-71797231 CCGGCTTGATTCTGACTGTTTGT No data
Right 932448901 2:71797252-71797274 CTGCCCTGGGCCTCAGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932448895 Original CRISPR ACAAACAGTCAGAATCAAGC CGG (reversed) Intergenic
No off target data available for this crispr