ID: 932449757

View in Genome Browser
Species Human (GRCh38)
Location 2:71802034-71802056
Sequence CTGTGGGGCCTCTTCTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932449757_932449762 -2 Left 932449757 2:71802034-71802056 CCAGAGCAGAAGAGGCCCCACAG No data
Right 932449762 2:71802055-71802077 AGTCCCTCCCAGGACCCAGAAGG No data
932449757_932449767 10 Left 932449757 2:71802034-71802056 CCAGAGCAGAAGAGGCCCCACAG No data
Right 932449767 2:71802067-71802089 GACCCAGAAGGCAGATGTCCTGG No data
932449757_932449768 11 Left 932449757 2:71802034-71802056 CCAGAGCAGAAGAGGCCCCACAG No data
Right 932449768 2:71802068-71802090 ACCCAGAAGGCAGATGTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932449757 Original CRISPR CTGTGGGGCCTCTTCTGCTC TGG (reversed) Intergenic