ID: 932450803

View in Genome Browser
Species Human (GRCh38)
Location 2:71809527-71809549
Sequence CTCACCTATTACAGCCACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932450803_932450805 4 Left 932450803 2:71809527-71809549 CCATTGTGGCTGTAATAGGTGAG No data
Right 932450805 2:71809554-71809576 TGCCCAACTCAAGATAACATGGG No data
932450803_932450811 17 Left 932450803 2:71809527-71809549 CCATTGTGGCTGTAATAGGTGAG No data
Right 932450811 2:71809567-71809589 ATAACATGGGAGGGCATTCAGGG No data
932450803_932450804 3 Left 932450803 2:71809527-71809549 CCATTGTGGCTGTAATAGGTGAG No data
Right 932450804 2:71809553-71809575 ATGCCCAACTCAAGATAACATGG No data
932450803_932450808 7 Left 932450803 2:71809527-71809549 CCATTGTGGCTGTAATAGGTGAG No data
Right 932450808 2:71809557-71809579 CCAACTCAAGATAACATGGGAGG No data
932450803_932450809 8 Left 932450803 2:71809527-71809549 CCATTGTGGCTGTAATAGGTGAG No data
Right 932450809 2:71809558-71809580 CAACTCAAGATAACATGGGAGGG No data
932450803_932450810 16 Left 932450803 2:71809527-71809549 CCATTGTGGCTGTAATAGGTGAG No data
Right 932450810 2:71809566-71809588 GATAACATGGGAGGGCATTCAGG No data
932450803_932450812 22 Left 932450803 2:71809527-71809549 CCATTGTGGCTGTAATAGGTGAG No data
Right 932450812 2:71809572-71809594 ATGGGAGGGCATTCAGGGTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932450803 Original CRISPR CTCACCTATTACAGCCACAA TGG (reversed) Intergenic
No off target data available for this crispr