ID: 932450804

View in Genome Browser
Species Human (GRCh38)
Location 2:71809553-71809575
Sequence ATGCCCAACTCAAGATAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932450803_932450804 3 Left 932450803 2:71809527-71809549 CCATTGTGGCTGTAATAGGTGAG No data
Right 932450804 2:71809553-71809575 ATGCCCAACTCAAGATAACATGG No data
932450802_932450804 4 Left 932450802 2:71809526-71809548 CCCATTGTGGCTGTAATAGGTGA No data
Right 932450804 2:71809553-71809575 ATGCCCAACTCAAGATAACATGG No data
932450800_932450804 11 Left 932450800 2:71809519-71809541 CCTGAAACCCATTGTGGCTGTAA No data
Right 932450804 2:71809553-71809575 ATGCCCAACTCAAGATAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932450804 Original CRISPR ATGCCCAACTCAAGATAACA TGG Intergenic
No off target data available for this crispr