ID: 932450975

View in Genome Browser
Species Human (GRCh38)
Location 2:71810663-71810685
Sequence CGTGCCTCCAGATAAGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932450970_932450975 -6 Left 932450970 2:71810646-71810668 CCTCCCACTGTGCCCTTCGTGCC No data
Right 932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG No data
932450964_932450975 27 Left 932450964 2:71810613-71810635 CCCCTCTGAACCTGACCACAGGA No data
Right 932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG No data
932450968_932450975 17 Left 932450968 2:71810623-71810645 CCTGACCACAGGAGCATCAGGCT No data
Right 932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG No data
932450971_932450975 -9 Left 932450971 2:71810649-71810671 CCCACTGTGCCCTTCGTGCCTCC No data
Right 932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG No data
932450969_932450975 12 Left 932450969 2:71810628-71810650 CCACAGGAGCATCAGGCTCCTCC No data
Right 932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG No data
932450966_932450975 25 Left 932450966 2:71810615-71810637 CCTCTGAACCTGACCACAGGAGC No data
Right 932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG No data
932450965_932450975 26 Left 932450965 2:71810614-71810636 CCCTCTGAACCTGACCACAGGAG No data
Right 932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG No data
932450972_932450975 -10 Left 932450972 2:71810650-71810672 CCACTGTGCCCTTCGTGCCTCCA No data
Right 932450975 2:71810663-71810685 CGTGCCTCCAGATAAGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932450975 Original CRISPR CGTGCCTCCAGATAAGCTCC AGG Intergenic
No off target data available for this crispr