ID: 932451551

View in Genome Browser
Species Human (GRCh38)
Location 2:71813757-71813779
Sequence CTCAGCTCCAGCACACCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932451551_932451552 12 Left 932451551 2:71813757-71813779 CCTCTTGGTGTGCTGGAGCTGAG No data
Right 932451552 2:71813792-71813814 AACCTTGACCCTCTTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932451551 Original CRISPR CTCAGCTCCAGCACACCAAG AGG (reversed) Intergenic
No off target data available for this crispr