ID: 932451552

View in Genome Browser
Species Human (GRCh38)
Location 2:71813792-71813814
Sequence AACCTTGACCCTCTTCTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932451551_932451552 12 Left 932451551 2:71813757-71813779 CCTCTTGGTGTGCTGGAGCTGAG No data
Right 932451552 2:71813792-71813814 AACCTTGACCCTCTTCTGCTTGG No data
932451549_932451552 23 Left 932451549 2:71813746-71813768 CCTGTCAGAGACCTCTTGGTGTG No data
Right 932451552 2:71813792-71813814 AACCTTGACCCTCTTCTGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932451552 Original CRISPR AACCTTGACCCTCTTCTGCT TGG Intergenic
No off target data available for this crispr