ID: 932451734

View in Genome Browser
Species Human (GRCh38)
Location 2:71814939-71814961
Sequence GGACAGTGCTTGGGTAAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932451727_932451734 26 Left 932451727 2:71814890-71814912 CCAGACTCTCTTTTAAGGAACAA No data
Right 932451734 2:71814939-71814961 GGACAGTGCTTGGGTAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932451734 Original CRISPR GGACAGTGCTTGGGTAAAAG AGG Intergenic
No off target data available for this crispr