ID: 932454469

View in Genome Browser
Species Human (GRCh38)
Location 2:71838869-71838891
Sequence CACTTTTATGCCACCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932454469_932454475 10 Left 932454469 2:71838869-71838891 CCCCAGAAGGTGGCATAAAAGTG No data
Right 932454475 2:71838902-71838924 TCTCTACCATGACTGAGGTGTGG No data
932454469_932454474 5 Left 932454469 2:71838869-71838891 CCCCAGAAGGTGGCATAAAAGTG No data
Right 932454474 2:71838897-71838919 AATATTCTCTACCATGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932454469 Original CRISPR CACTTTTATGCCACCTTCTG GGG (reversed) Intergenic
No off target data available for this crispr