ID: 932454474

View in Genome Browser
Species Human (GRCh38)
Location 2:71838897-71838919
Sequence AATATTCTCTACCATGACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932454470_932454474 4 Left 932454470 2:71838870-71838892 CCCAGAAGGTGGCATAAAAGTGA No data
Right 932454474 2:71838897-71838919 AATATTCTCTACCATGACTGAGG No data
932454467_932454474 7 Left 932454467 2:71838867-71838889 CCCCCCAGAAGGTGGCATAAAAG No data
Right 932454474 2:71838897-71838919 AATATTCTCTACCATGACTGAGG No data
932454468_932454474 6 Left 932454468 2:71838868-71838890 CCCCCAGAAGGTGGCATAAAAGT No data
Right 932454474 2:71838897-71838919 AATATTCTCTACCATGACTGAGG No data
932454469_932454474 5 Left 932454469 2:71838869-71838891 CCCCAGAAGGTGGCATAAAAGTG No data
Right 932454474 2:71838897-71838919 AATATTCTCTACCATGACTGAGG No data
932454471_932454474 3 Left 932454471 2:71838871-71838893 CCAGAAGGTGGCATAAAAGTGAT No data
Right 932454474 2:71838897-71838919 AATATTCTCTACCATGACTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932454474 Original CRISPR AATATTCTCTACCATGACTG AGG Intergenic
No off target data available for this crispr