ID: 932454475

View in Genome Browser
Species Human (GRCh38)
Location 2:71838902-71838924
Sequence TCTCTACCATGACTGAGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932454469_932454475 10 Left 932454469 2:71838869-71838891 CCCCAGAAGGTGGCATAAAAGTG No data
Right 932454475 2:71838902-71838924 TCTCTACCATGACTGAGGTGTGG No data
932454471_932454475 8 Left 932454471 2:71838871-71838893 CCAGAAGGTGGCATAAAAGTGAT No data
Right 932454475 2:71838902-71838924 TCTCTACCATGACTGAGGTGTGG No data
932454468_932454475 11 Left 932454468 2:71838868-71838890 CCCCCAGAAGGTGGCATAAAAGT No data
Right 932454475 2:71838902-71838924 TCTCTACCATGACTGAGGTGTGG No data
932454467_932454475 12 Left 932454467 2:71838867-71838889 CCCCCCAGAAGGTGGCATAAAAG No data
Right 932454475 2:71838902-71838924 TCTCTACCATGACTGAGGTGTGG No data
932454470_932454475 9 Left 932454470 2:71838870-71838892 CCCAGAAGGTGGCATAAAAGTGA No data
Right 932454475 2:71838902-71838924 TCTCTACCATGACTGAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932454475 Original CRISPR TCTCTACCATGACTGAGGTG TGG Intergenic
No off target data available for this crispr