ID: 932457198

View in Genome Browser
Species Human (GRCh38)
Location 2:71857408-71857430
Sequence CAGCCCTAATGGCCCTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932457188_932457198 6 Left 932457188 2:71857379-71857401 CCTACTGCCCTATTTCCCTTCTT No data
Right 932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG No data
932457193_932457198 -2 Left 932457193 2:71857387-71857409 CCTATTTCCCTTCTTGGGGTGCA No data
Right 932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG No data
932457185_932457198 14 Left 932457185 2:71857371-71857393 CCTTCCTCCCTACTGCCCTATTT No data
Right 932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG No data
932457195_932457198 -10 Left 932457195 2:71857395-71857417 CCTTCTTGGGGTGCAGCCCTAAT No data
Right 932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG No data
932457186_932457198 10 Left 932457186 2:71857375-71857397 CCTCCCTACTGCCCTATTTCCCT No data
Right 932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG No data
932457192_932457198 -1 Left 932457192 2:71857386-71857408 CCCTATTTCCCTTCTTGGGGTGC No data
Right 932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG No data
932457194_932457198 -9 Left 932457194 2:71857394-71857416 CCCTTCTTGGGGTGCAGCCCTAA No data
Right 932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG No data
932457187_932457198 7 Left 932457187 2:71857378-71857400 CCCTACTGCCCTATTTCCCTTCT No data
Right 932457198 2:71857408-71857430 CAGCCCTAATGGCCCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932457198 Original CRISPR CAGCCCTAATGGCCCTCAGT GGG Intergenic
No off target data available for this crispr