ID: 932459544

View in Genome Browser
Species Human (GRCh38)
Location 2:71873344-71873366
Sequence ACTACTTAGGGCATCCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932459544_932459554 13 Left 932459544 2:71873344-71873366 CCTGAGGGGATGCCCTAAGTAGT No data
Right 932459554 2:71873380-71873402 GGGCCACAGCTTCAGCAGATTGG No data
932459544_932459550 -7 Left 932459544 2:71873344-71873366 CCTGAGGGGATGCCCTAAGTAGT No data
Right 932459550 2:71873360-71873382 AAGTAGTGTGGGTCCCCTGAGGG No data
932459544_932459549 -8 Left 932459544 2:71873344-71873366 CCTGAGGGGATGCCCTAAGTAGT No data
Right 932459549 2:71873359-71873381 TAAGTAGTGTGGGTCCCCTGAGG No data
932459544_932459555 14 Left 932459544 2:71873344-71873366 CCTGAGGGGATGCCCTAAGTAGT No data
Right 932459555 2:71873381-71873403 GGCCACAGCTTCAGCAGATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932459544 Original CRISPR ACTACTTAGGGCATCCCCTC AGG (reversed) Intergenic
No off target data available for this crispr