ID: 932459631

View in Genome Browser
Species Human (GRCh38)
Location 2:71873840-71873862
Sequence CAAGGAGAGCAGAGAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932459620_932459631 19 Left 932459620 2:71873798-71873820 CCACCTGCTGGAGACCTGCCCTA No data
Right 932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG No data
932459625_932459631 1 Left 932459625 2:71873816-71873838 CCCTAAAAGAAAAGGGTCCTGTG No data
Right 932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG No data
932459626_932459631 0 Left 932459626 2:71873817-71873839 CCTAAAAGAAAAGGGTCCTGTGC No data
Right 932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG No data
932459621_932459631 16 Left 932459621 2:71873801-71873823 CCTGCTGGAGACCTGCCCTAAAA No data
Right 932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG No data
932459619_932459631 26 Left 932459619 2:71873791-71873813 CCAATCGCCACCTGCTGGAGACC No data
Right 932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG No data
932459624_932459631 5 Left 932459624 2:71873812-71873834 CCTGCCCTAAAAGAAAAGGGTCC No data
Right 932459631 2:71873840-71873862 CAAGGAGAGCAGAGAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932459631 Original CRISPR CAAGGAGAGCAGAGAGTTGA GGG Intergenic
No off target data available for this crispr