ID: 932462398

View in Genome Browser
Species Human (GRCh38)
Location 2:71891428-71891450
Sequence GGGCTTCTCTGCGGGTGCTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932462398_932462412 16 Left 932462398 2:71891428-71891450 CCGCAGCACCCGCAGAGAAGCCC No data
Right 932462412 2:71891467-71891489 CCTCAAGTGTTGCTCACTGATGG No data
932462398_932462413 30 Left 932462398 2:71891428-71891450 CCGCAGCACCCGCAGAGAAGCCC No data
Right 932462413 2:71891481-71891503 CACTGATGGTGCAGCAGAGCTGG No data
932462398_932462407 -10 Left 932462398 2:71891428-71891450 CCGCAGCACCCGCAGAGAAGCCC No data
Right 932462407 2:71891441-71891463 AGAGAAGCCCTGGGGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932462398 Original CRISPR GGGCTTCTCTGCGGGTGCTG CGG (reversed) Intergenic
No off target data available for this crispr