ID: 932464423

View in Genome Browser
Species Human (GRCh38)
Location 2:71907204-71907226
Sequence GGTCTTATTGAACCAGACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932464419_932464423 0 Left 932464419 2:71907181-71907203 CCTTGCTCCACCAAATTCTTCTT No data
Right 932464423 2:71907204-71907226 GGTCTTATTGAACCAGACCCAGG No data
932464422_932464423 -10 Left 932464422 2:71907191-71907213 CCAAATTCTTCTTGGTCTTATTG No data
Right 932464423 2:71907204-71907226 GGTCTTATTGAACCAGACCCAGG No data
932464418_932464423 4 Left 932464418 2:71907177-71907199 CCAACCTTGCTCCACCAAATTCT No data
Right 932464423 2:71907204-71907226 GGTCTTATTGAACCAGACCCAGG No data
932464421_932464423 -7 Left 932464421 2:71907188-71907210 CCACCAAATTCTTCTTGGTCTTA No data
Right 932464423 2:71907204-71907226 GGTCTTATTGAACCAGACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932464423 Original CRISPR GGTCTTATTGAACCAGACCC AGG Intergenic
No off target data available for this crispr