ID: 932467039

View in Genome Browser
Species Human (GRCh38)
Location 2:71930543-71930565
Sequence TCTCCCATGCTGAAAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932467039_932467046 -8 Left 932467039 2:71930543-71930565 CCCTCCCCTTTCAGCATGGGAGA No data
Right 932467046 2:71930558-71930580 ATGGGAGACTCGGTGGAGTCAGG No data
932467039_932467047 -4 Left 932467039 2:71930543-71930565 CCCTCCCCTTTCAGCATGGGAGA No data
Right 932467047 2:71930562-71930584 GAGACTCGGTGGAGTCAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932467039 Original CRISPR TCTCCCATGCTGAAAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr