ID: 932471275

View in Genome Browser
Species Human (GRCh38)
Location 2:71961048-71961070
Sequence CTCCAAGGGAACCAGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932471275_932471282 -8 Left 932471275 2:71961048-71961070 CCCTGGCCCTGGTTCCCTTGGAG No data
Right 932471282 2:71961063-71961085 CCTTGGAGGCTTCTGTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932471275 Original CRISPR CTCCAAGGGAACCAGGGCCA GGG (reversed) Intergenic
No off target data available for this crispr