ID: 932476352

View in Genome Browser
Species Human (GRCh38)
Location 2:72008764-72008786
Sequence CACTGCTCGGGAGCACCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932476345_932476352 19 Left 932476345 2:72008722-72008744 CCAACACGGACAGGCGTGGACGG No data
Right 932476352 2:72008764-72008786 CACTGCTCGGGAGCACCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932476352 Original CRISPR CACTGCTCGGGAGCACCAGG AGG Intergenic
No off target data available for this crispr