ID: 932477408

View in Genome Browser
Species Human (GRCh38)
Location 2:72014874-72014896
Sequence GTTCTGCCTCACCATCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932477408_932477412 -10 Left 932477408 2:72014874-72014896 CCCCTCTGATGGTGAGGCAGAAC No data
Right 932477412 2:72014887-72014909 GAGGCAGAACCTTCAGTAATGGG No data
932477408_932477413 -7 Left 932477408 2:72014874-72014896 CCCCTCTGATGGTGAGGCAGAAC No data
Right 932477413 2:72014890-72014912 GCAGAACCTTCAGTAATGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932477408 Original CRISPR GTTCTGCCTCACCATCAGAG GGG (reversed) Intergenic
No off target data available for this crispr