ID: 932478572

View in Genome Browser
Species Human (GRCh38)
Location 2:72024437-72024459
Sequence CCTCCTAGTGGAGCACAAAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932478572_932478575 23 Left 932478572 2:72024437-72024459 CCGGTTTGTGCTCCACTAGGAGG No data
Right 932478575 2:72024483-72024505 CGTTTCCCAATAGTGCAGCCTGG No data
932478572_932478576 24 Left 932478572 2:72024437-72024459 CCGGTTTGTGCTCCACTAGGAGG No data
Right 932478576 2:72024484-72024506 GTTTCCCAATAGTGCAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932478572 Original CRISPR CCTCCTAGTGGAGCACAAAC CGG (reversed) Intergenic
No off target data available for this crispr