ID: 932480171

View in Genome Browser
Species Human (GRCh38)
Location 2:72034459-72034481
Sequence GGACCCCGCTTCAAGGAAGT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932480163_932480171 13 Left 932480163 2:72034423-72034445 CCAGAGCCTAGGGAGGGCACCCC No data
Right 932480171 2:72034459-72034481 GGACCCCGCTTCAAGGAAGTCGG No data
932480167_932480171 -6 Left 932480167 2:72034442-72034464 CCCCATGCTAAGGAGCAGGACCC No data
Right 932480171 2:72034459-72034481 GGACCCCGCTTCAAGGAAGTCGG No data
932480164_932480171 7 Left 932480164 2:72034429-72034451 CCTAGGGAGGGCACCCCATGCTA No data
Right 932480171 2:72034459-72034481 GGACCCCGCTTCAAGGAAGTCGG No data
932480169_932480171 -8 Left 932480169 2:72034444-72034466 CCATGCTAAGGAGCAGGACCCCG No data
Right 932480171 2:72034459-72034481 GGACCCCGCTTCAAGGAAGTCGG No data
932480162_932480171 14 Left 932480162 2:72034422-72034444 CCCAGAGCCTAGGGAGGGCACCC No data
Right 932480171 2:72034459-72034481 GGACCCCGCTTCAAGGAAGTCGG No data
932480168_932480171 -7 Left 932480168 2:72034443-72034465 CCCATGCTAAGGAGCAGGACCCC No data
Right 932480171 2:72034459-72034481 GGACCCCGCTTCAAGGAAGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932480171 Original CRISPR GGACCCCGCTTCAAGGAAGT CGG Intergenic