ID: 932484875

View in Genome Browser
Species Human (GRCh38)
Location 2:72078668-72078690
Sequence GGTGCTGTTGCCAGATTGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932484875_932484882 26 Left 932484875 2:72078668-72078690 CCTTGCAATCTGGCAACAGCACC No data
Right 932484882 2:72078717-72078739 AGAAAAGCAAACTGAGTCTCAGG No data
932484875_932484879 -4 Left 932484875 2:72078668-72078690 CCTTGCAATCTGGCAACAGCACC No data
Right 932484879 2:72078687-72078709 CACCATGGGGTTCGTACTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932484875 Original CRISPR GGTGCTGTTGCCAGATTGCA AGG (reversed) Intergenic
No off target data available for this crispr