ID: 932487358

View in Genome Browser
Species Human (GRCh38)
Location 2:72092291-72092313
Sequence ACTGCTCCTTCTGTTCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932487358_932487361 -9 Left 932487358 2:72092291-72092313 CCCAGGAGAACAGAAGGAGCAGT No data
Right 932487361 2:72092305-72092327 AGGAGCAGTGGTTCACACCAAGG No data
932487358_932487362 -8 Left 932487358 2:72092291-72092313 CCCAGGAGAACAGAAGGAGCAGT No data
Right 932487362 2:72092306-72092328 GGAGCAGTGGTTCACACCAAGGG No data
932487358_932487364 6 Left 932487358 2:72092291-72092313 CCCAGGAGAACAGAAGGAGCAGT No data
Right 932487364 2:72092320-72092342 CACCAAGGGGAAGCGCTCCCTGG No data
932487358_932487363 -7 Left 932487358 2:72092291-72092313 CCCAGGAGAACAGAAGGAGCAGT No data
Right 932487363 2:72092307-72092329 GAGCAGTGGTTCACACCAAGGGG No data
932487358_932487367 8 Left 932487358 2:72092291-72092313 CCCAGGAGAACAGAAGGAGCAGT No data
Right 932487367 2:72092322-72092344 CCAAGGGGAAGCGCTCCCTGGGG No data
932487358_932487368 13 Left 932487358 2:72092291-72092313 CCCAGGAGAACAGAAGGAGCAGT No data
Right 932487368 2:72092327-72092349 GGGAAGCGCTCCCTGGGGTGTGG No data
932487358_932487365 7 Left 932487358 2:72092291-72092313 CCCAGGAGAACAGAAGGAGCAGT No data
Right 932487365 2:72092321-72092343 ACCAAGGGGAAGCGCTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932487358 Original CRISPR ACTGCTCCTTCTGTTCTCCT GGG (reversed) Intergenic
No off target data available for this crispr