ID: 932490252

View in Genome Browser
Species Human (GRCh38)
Location 2:72115716-72115738
Sequence CTCCCTTCGAAGCCTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932490248_932490252 -2 Left 932490248 2:72115695-72115717 CCCCAGAGAACTTGAATTGAGCT No data
Right 932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG No data
932490250_932490252 -4 Left 932490250 2:72115697-72115719 CCAGAGAACTTGAATTGAGCTCC No data
Right 932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG No data
932490249_932490252 -3 Left 932490249 2:72115696-72115718 CCCAGAGAACTTGAATTGAGCTC No data
Right 932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG No data
932490247_932490252 24 Left 932490247 2:72115669-72115691 CCGAGGGCAGAAAAGGCTCTCAG No data
Right 932490252 2:72115716-72115738 CTCCCTTCGAAGCCTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932490252 Original CRISPR CTCCCTTCGAAGCCTGGCCC TGG Intergenic
No off target data available for this crispr