ID: 932493413

View in Genome Browser
Species Human (GRCh38)
Location 2:72135080-72135102
Sequence ATGAGCCCCCTCTCTGGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932493413_932493424 11 Left 932493413 2:72135080-72135102 CCACCCCCAGAGAGGGGGCTCAT 0: 1
1: 0
2: 1
3: 19
4: 209
Right 932493424 2:72135114-72135136 CTCCTCTCCTCCCAGGCCCTGGG 0: 1
1: 1
2: 6
3: 100
4: 876
932493413_932493419 4 Left 932493413 2:72135080-72135102 CCACCCCCAGAGAGGGGGCTCAT 0: 1
1: 0
2: 1
3: 19
4: 209
Right 932493419 2:72135107-72135129 GCCCCTGCTCCTCTCCTCCCAGG 0: 1
1: 0
2: 13
3: 90
4: 757
932493413_932493423 10 Left 932493413 2:72135080-72135102 CCACCCCCAGAGAGGGGGCTCAT 0: 1
1: 0
2: 1
3: 19
4: 209
Right 932493423 2:72135113-72135135 GCTCCTCTCCTCCCAGGCCCTGG 0: 1
1: 3
2: 12
3: 135
4: 1031
932493413_932493429 25 Left 932493413 2:72135080-72135102 CCACCCCCAGAGAGGGGGCTCAT 0: 1
1: 0
2: 1
3: 19
4: 209
Right 932493429 2:72135128-72135150 GGCCCTGGGTGCTCACCCGCCGG 0: 1
1: 0
2: 3
3: 14
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932493413 Original CRISPR ATGAGCCCCCTCTCTGGGGG TGG (reversed) Intronic