ID: 932493625

View in Genome Browser
Species Human (GRCh38)
Location 2:72136098-72136120
Sequence CACCCAGGACTCCCCCGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 161}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932493616_932493625 -5 Left 932493616 2:72136080-72136102 CCCCCTTGCCACCCTCCTCACCC 0: 1
1: 3
2: 17
3: 143
4: 1347
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493613_932493625 13 Left 932493613 2:72136062-72136084 CCCGGCTGGCTGCGCAGCCCCCC 0: 1
1: 0
2: 5
3: 32
4: 385
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493612_932493625 16 Left 932493612 2:72136059-72136081 CCTCCCGGCTGGCTGCGCAGCCC 0: 1
1: 1
2: 2
3: 30
4: 319
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493618_932493625 -7 Left 932493618 2:72136082-72136104 CCCTTGCCACCCTCCTCACCCAG 0: 1
1: 0
2: 5
3: 61
4: 613
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493611_932493625 20 Left 932493611 2:72136055-72136077 CCGTCCTCCCGGCTGGCTGCGCA 0: 1
1: 0
2: 2
3: 16
4: 185
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493615_932493625 -4 Left 932493615 2:72136079-72136101 CCCCCCTTGCCACCCTCCTCACC 0: 1
1: 1
2: 8
3: 130
4: 1138
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493610_932493625 23 Left 932493610 2:72136052-72136074 CCTCCGTCCTCCCGGCTGGCTGC 0: 1
1: 0
2: 3
3: 15
4: 330
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493614_932493625 12 Left 932493614 2:72136063-72136085 CCGGCTGGCTGCGCAGCCCCCCT 0: 1
1: 0
2: 1
3: 24
4: 297
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493617_932493625 -6 Left 932493617 2:72136081-72136103 CCCCTTGCCACCCTCCTCACCCA 0: 1
1: 0
2: 8
3: 94
4: 900
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493619_932493625 -8 Left 932493619 2:72136083-72136105 CCTTGCCACCCTCCTCACCCAGG 0: 1
1: 1
2: 11
3: 83
4: 791
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161
932493608_932493625 29 Left 932493608 2:72136046-72136068 CCTTGTCCTCCGTCCTCCCGGCT 0: 1
1: 0
2: 0
3: 42
4: 328
Right 932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG 0: 1
1: 0
2: 0
3: 19
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932493625 Original CRISPR CACCCAGGACTCCCCCGCAC AGG Intronic
900299476 1:1969694-1969716 CTGCCAGGACCCCCCCGCCCAGG + Intronic
900497372 1:2982146-2982168 CACCCAGGACCCCCGCACACTGG - Intergenic
900507537 1:3037203-3037225 CACCCACCCCTCCCCAGCACAGG + Intergenic
902348370 1:15835570-15835592 CCCCCGAGACTCCCCAGCACGGG - Intergenic
903281604 1:22253131-22253153 CACCCAGGGCACCCCCGGCCAGG - Intergenic
903420029 1:23212259-23212281 CACACTGGACTCCCCTGGACTGG + Intergenic
904031795 1:27537667-27537689 CACCCAGGGCTAGCACGCACCGG + Intronic
905185975 1:36197086-36197108 CACCCAGGAATCCCGCGCCAGGG - Intergenic
905907046 1:41626177-41626199 CACCCCGCCCTCCCCAGCACCGG + Intronic
906145678 1:43558741-43558763 CCCCCAGGGCTCCCCCTCCCTGG - Intronic
907345368 1:53773810-53773832 CACCCACAACTCCCCCAGACTGG + Intronic
912436762 1:109667858-109667880 CAACCAGTTCTCCCCCGCCCTGG + Intronic
919820238 1:201468077-201468099 CACCCAGGTATCCCCCTCCCAGG + Intronic
921370874 1:214421942-214421964 CCCCCAGGCCTCTCCTGCACTGG + Intronic
922062356 1:222104635-222104657 CACGCAGGACTCCCCCTCAAGGG - Intergenic
923526506 1:234776951-234776973 CACCCACGTTTCCCCAGCACAGG + Intergenic
1063369857 10:5514128-5514150 CACCCACCACCCCCCAGCACAGG + Intergenic
1067160541 10:43821491-43821513 TTCCCAGGACTCCACCCCACTGG + Intergenic
1069820639 10:71225500-71225522 CACCCGGGCCTCCTCCGCTCTGG - Intronic
1069893637 10:71667155-71667177 CTCACAGGAATGCCCCGCACGGG - Intronic
1069903543 10:71719550-71719572 CTCCCAGGAGTCCCCAGCAAGGG + Intronic
1072753194 10:97999178-97999200 GACCCAGGACTCCCACGCAGGGG + Intronic
1073514567 10:104065049-104065071 GACCAAGGACTCCCCTGCCCAGG - Intronic
1074308341 10:112299524-112299546 CGACCAGGACTCCCCCGGTCTGG - Exonic
1074820304 10:117173532-117173554 CCCCCAGGCCTCCCCTGCTCAGG - Intergenic
1075484788 10:122813319-122813341 AACCCAGGAGTCCCCTCCACTGG + Intergenic
1075960200 10:126562012-126562034 CACCCAGGACTCTCCAGCTGAGG - Intronic
1076683855 10:132187901-132187923 CCCCATGGACTCCCCCGCCCAGG - Intronic
1080746825 11:35115740-35115762 GACCCAGGAGTGCCCCGCACTGG + Intergenic
1081848040 11:46254462-46254484 CACCCAGGTCTCCCCCGTCCTGG + Intergenic
1083162503 11:60863526-60863548 CACCAAGGACGCACCAGCACAGG + Intergenic
1083272732 11:61580430-61580452 CACCCGAGGCTCCCCAGCACCGG - Intronic
1084426479 11:69086974-69086996 CACCCTGGACACCCAGGCACAGG - Intronic
1084474348 11:69380488-69380510 CACACAGGCCTCCCTGGCACAGG - Intergenic
1088367397 11:109054009-109054031 CAACCAGGACTCCCCCACCCAGG - Intergenic
1091791328 12:3273785-3273807 GAGCCAGGCCTGCCCCGCACAGG - Intronic
1092140597 12:6180711-6180733 CAGCCAGGCCTGCCCCGCAGTGG - Intergenic
1092160374 12:6312356-6312378 CAGCCTGGACTCACCAGCACAGG - Exonic
1097264795 12:57738646-57738668 CGCCCCTGCCTCCCCCGCACAGG - Intronic
1103943887 12:124515919-124515941 CACCCAGGACTCTTCTCCACCGG + Intronic
1108492106 13:50992031-50992053 CCCCCAGCACTCACTCGCACGGG - Intergenic
1108510227 13:51148876-51148898 CTCCCAGGACTCCACGGCTCAGG + Intergenic
1112840638 13:103573342-103573364 AGCCCAGGACTCCCCCACACTGG + Intergenic
1114152842 14:20064199-20064221 CACCCAGTAATTCCCTGCACAGG - Intergenic
1119731930 14:76956625-76956647 CCCCCAGGCCTCCCCCGAGCGGG + Intergenic
1122635654 14:103128478-103128500 GCCCCTGGACTCCCCCGCCCTGG - Intronic
1123630783 15:22258297-22258319 CCCCCCGGCCTCCCCCGCGCGGG + Intergenic
1125769604 15:42156388-42156410 CTCCCAGGACTCCCCCAGTCCGG + Intronic
1125844987 15:42843877-42843899 CACCCAGGCGTCCCCCACCCAGG + Intronic
1125965028 15:43867290-43867312 CAGGCAGGACTCCCAAGCACCGG + Exonic
1129776612 15:78241141-78241163 CACCCAGGTCTCCACAGGACTGG + Intronic
1130296066 15:82647729-82647751 CGCCCGGGACTCGCCCGCACGGG + Intronic
1132561020 16:594033-594055 CCCCCAGGAACCACCCGCACAGG + Intronic
1134076604 16:11296344-11296366 CACCCTGGACTCCTCCACAGAGG - Intronic
1138492024 16:57382498-57382520 CACCCAGGACCCCTCCACCCAGG + Exonic
1140091891 16:71845890-71845912 CGCCCAGGACTCCCCGGGAAGGG - Intergenic
1140707225 16:77641937-77641959 CAACCAGGACTCACTCCCACTGG - Intergenic
1142197873 16:88746999-88747021 CTCCCAGCACTCGGCCGCACTGG + Intronic
1142238655 16:88935186-88935208 AACCCAGGACTGCCCCTGACCGG - Intronic
1142412085 16:89922016-89922038 CACCCCGGACTCCCTTGAACAGG + Intronic
1144496472 17:15749327-15749349 CGCCCAGGACGCGCCCGCGCTGG - Intergenic
1144606056 17:16666731-16666753 CGCCCAGGACGCGCCCGCGCTGG - Intergenic
1145905610 17:28514597-28514619 CACCCAGGGCTCCACCCGACAGG - Intronic
1147816108 17:43212003-43212025 CACACAGGCGCCCCCCGCACGGG + Intronic
1148634951 17:49141877-49141899 GACCCTGGAGTCCCCTGCACTGG - Intronic
1148688296 17:49512898-49512920 CACCCAGGACAGCGCCACACTGG + Exonic
1148777808 17:50105440-50105462 CACCCAGGGCCCCCACTCACTGG - Exonic
1150226413 17:63527039-63527061 CACCCACGCCTGCCCCGCACTGG + Intronic
1150410957 17:64940211-64940233 CCCCCAGGCAGCCCCCGCACAGG - Intergenic
1152287765 17:79422480-79422502 CACCCAGGGCTTCCCGGCCCAGG + Intronic
1152662474 17:81549123-81549145 CACCCAGGACGACCCCACACAGG + Intronic
1159106099 18:64002983-64003005 AACGCAGGACTCCCGGGCACTGG - Intronic
1159894170 18:73980805-73980827 CCCCCGGGACTCCCACTCACAGG + Intergenic
1160168293 18:76532085-76532107 CACCCAGGACCCACCTGCCCAGG - Intergenic
1160168300 18:76532100-76532122 CACCCAGGACCCACCCACCCAGG - Intergenic
1160168332 18:76532206-76532228 CACCCAGGACTCACCTGACCAGG - Intergenic
1160303601 18:77709311-77709333 CTCCCGGGACTCCCCAGCCCTGG - Intergenic
1160710070 19:547371-547393 GCACCAGGACACCCCCGCACAGG - Exonic
1160776891 19:860708-860730 CCACCAGGACGCCGCCGCACAGG - Exonic
1161024331 19:2028641-2028663 CACCCAGGCTTCCCCGACACAGG + Intronic
1161119158 19:2515796-2515818 CAGCCATCACTCCCCAGCACCGG - Intronic
1161189544 19:2945362-2945384 CACGCAGGACTCCGCCCCATGGG - Intergenic
1165061902 19:33208956-33208978 CCCCCAGGACGCCCCCGAAGAGG - Exonic
1165730481 19:38141634-38141656 AACCCAGAGCTCCCCAGCACTGG - Intronic
1165805450 19:38578052-38578074 AGCCCAGGACACCCCTGCACAGG + Intronic
1167331415 19:48858881-48858903 CCCCCAGGAGTCCCCAGCACTGG - Exonic
1167501443 19:49851006-49851028 TTCCCAGGACTCCCCCGCGCCGG + Intronic
925409882 2:3633834-3633856 TACCCAGCTCTCCACCGCACCGG - Intronic
925686116 2:6475705-6475727 CTCCTAGGACTCCCACGCCCTGG - Intergenic
932213249 2:69948834-69948856 CACTCAGGCCTCCCCCGCGGCGG + Intergenic
932493625 2:72136098-72136120 CACCCAGGACTCCCCCGCACAGG + Intronic
932586033 2:73029612-73029634 CACCTAGGTCTCCCCGGCACTGG + Intronic
932657273 2:73620920-73620942 TACTCAGGAGTCCCCCACACTGG + Intergenic
932663951 2:73681168-73681190 TACTCAGGAGTCCCCCACACTGG + Intergenic
939267344 2:139891182-139891204 AACCCAGGACTCAGCCACACAGG + Intergenic
946404093 2:219483619-219483641 CACCCAGGCCTCCCCGGGCCAGG - Exonic
948386909 2:237586122-237586144 CACACAGGACCCCCCAGCCCAGG - Exonic
948464783 2:238147304-238147326 CACCCAGGGCTCCCGAGCCCAGG + Intronic
948591612 2:239054115-239054137 AAGCCAGGACTCCCTCACACAGG + Intronic
1168765949 20:381601-381623 CACCCAGGACTCTCCCCTGCGGG - Intronic
1171188625 20:23142151-23142173 GACCAAGTCCTCCCCCGCACAGG + Intergenic
1172125041 20:32620787-32620809 CAGCCAGGACTCCTCCTCACAGG - Intergenic
1172526485 20:35602923-35602945 CACCTAGGCCTCACCCGCTCCGG + Intergenic
1173251430 20:41366091-41366113 CACGCGGGGCTCCCCCGCCCCGG - Intronic
1175402210 20:58707220-58707242 CACCCAGGATGCCCCTGCAGAGG - Intronic
1176090160 20:63315069-63315091 CACCCAGGAGTGCCCTGAACTGG - Intronic
1176258139 20:64164320-64164342 GACACAGGACTCCACCGGACTGG + Intronic
1180119064 21:45734457-45734479 CACTCAGGACCCCACAGCACAGG - Intronic
1181583996 22:23842954-23842976 CACCCAGCTTTCCCCCTCACTGG + Intergenic
1182059894 22:27389278-27389300 CTCCCAGGTCTCCCCAGCTCAGG + Intergenic
1183186379 22:36293782-36293804 CACCAAGGACTTCTCCGCGCTGG - Exonic
1183189701 22:36313969-36313991 CACCCAGGCCTCCCAGGCACTGG + Intronic
1184343744 22:43900613-43900635 CACCCCACACTCCCCTGCACAGG + Intergenic
1184347635 22:43923555-43923577 CAGGCTGGACCCCCCCGCACAGG + Intergenic
1184470295 22:44692242-44692264 CACCCAGGGCTCCTCCTCCCGGG + Intronic
1184470422 22:44692563-44692585 CACCCAGGGCTCCTCCTCCCGGG + Intronic
1184730671 22:46369446-46369468 CACCCAGGAGGGTCCCGCACAGG - Intronic
950910406 3:16583789-16583811 CAACCAGCACTCCCGGGCACAGG + Intergenic
954661734 3:52230188-52230210 CTCCCAAGACTCCCCTGCAATGG + Intronic
954714666 3:52521100-52521122 CACCCAGAGCTCCCCAGCCCTGG - Intronic
960057715 3:113287089-113287111 CACCCAGGAAAGCACCGCACAGG + Exonic
966931526 3:184678684-184678706 CACCCTGGTCTCTCCCGAACTGG - Intronic
968575996 4:1366445-1366467 CACCCAGGTGCCCCCCCCACGGG - Intronic
969572011 4:8014633-8014655 CACCCATGTATCCCCAGCACTGG + Intronic
969594420 4:8140878-8140900 CACCCAGGCCTCCTCTGCATTGG - Intronic
975172455 4:71247773-71247795 CACCCAGAACCACCCCACACGGG - Intronic
982292432 4:153792482-153792504 CACCCAGGCCTTCCCTGCTCCGG + Intergenic
982460152 4:155659653-155659675 CACACAGGACACCCACTCACTGG - Intergenic
991962800 5:72062635-72062657 CACCAAGGACACTCCTGCACTGG - Intergenic
991971110 5:72142262-72142284 CGCCCAGGACTCCATCTCACAGG - Intronic
997388580 5:133495233-133495255 CACCCAGCCCTTCCCCGCAGAGG - Intronic
997530189 5:134577165-134577187 CACCCAGGACCCCCCAGCCAGGG - Intronic
998167110 5:139850512-139850534 CAGCCAGGCCTGCCCAGCACAGG + Intronic
999238502 5:150114129-150114151 TAGCCAAGACGCCCCCGCACGGG - Exonic
999381974 5:151127672-151127694 CAGCCAGTTCTCCCCAGCACAGG + Intronic
1001101743 5:168819928-168819950 CACCCTGGACTCCACTGCCCTGG - Intronic
1002252462 5:177938389-177938411 ACCCCAGGACCCCCCAGCACAGG + Intergenic
1002634036 5:180598398-180598420 CACACAGGACTGCCCGGCCCTGG - Intergenic
1003873582 6:10419302-10419324 CACCTACGACTCCCCTGCCCTGG + Intronic
1006633124 6:35443437-35443459 CACCTAGGACTGGCCCGCAGGGG + Intergenic
1007735786 6:43981517-43981539 CAGCCAGGACACCCCTGCCCTGG + Intergenic
1013074102 6:106755243-106755265 CACCCAGGATCCCCTCACACAGG - Intergenic
1015897230 6:138029086-138029108 CACGCAGTACTTCCCAGCACTGG + Intergenic
1019145328 6:169972178-169972200 CACCCAGGACTCTCGTGCAGTGG + Intergenic
1019309725 7:354084-354106 CGCCCAGGCTGCCCCCGCACTGG - Intergenic
1019625080 7:2011832-2011854 CCCCCAGGACCCCGCTGCACTGG - Intronic
1020098885 7:5383348-5383370 GACCCAGGGCTCCCCTGCACAGG + Intronic
1022662755 7:32381816-32381838 TACCCACCACTACCCCGCACTGG + Intergenic
1022723809 7:32963290-32963312 CACCCAGGCCTCCCAAGGACTGG - Intronic
1023865275 7:44235399-44235421 CACCCAGCATTCCCCCTCAGAGG + Intronic
1024085313 7:45887777-45887799 CACCCATGACTTTCCCGCATAGG - Intergenic
1025049816 7:55724626-55724648 CACCCAGGCCTCCCAAGGACTGG + Intergenic
1026314126 7:69213061-69213083 CACCCAGGACTTCCTCACAAGGG + Intergenic
1026833424 7:73623528-73623550 AACCCAGGCCTCCCGGGCACCGG + Intronic
1026944079 7:74305327-74305349 CAGCCTGGCCTCCCCCGCAAAGG + Intronic
1030981660 7:116192162-116192184 GACCCAGGAGTCCCACTCACAGG - Intergenic
1032020802 7:128406258-128406280 CACCCAGGACCCCCCAGCAGAGG + Intronic
1035206976 7:157300132-157300154 AACCCCGGGCTCCCCCGCCCCGG - Intergenic
1036675475 8:10828485-10828507 CACCCAGGAAGCCCCCGCGATGG + Intronic
1036787969 8:11700578-11700600 CACTCAGTCCTCACCCGCACGGG - Intronic
1037812501 8:22095332-22095354 CGCCCAGGACAGCCCCGCGCAGG - Intronic
1038397476 8:27257725-27257747 CACCCAGAACTGCCACGCCCTGG - Intronic
1040292510 8:46132680-46132702 CACCCAGGATTCTCCCGGGCGGG - Intergenic
1040304573 8:46205372-46205394 CACCCAGGTCTGTCCCGGACGGG + Intergenic
1040305423 8:46209396-46209418 CCCCCAGGACTGTCCCGGACAGG + Intergenic
1042006281 8:64183363-64183385 CACCTTGGCCTCCCCAGCACAGG + Intergenic
1043366916 8:79543418-79543440 CAGCCAGGTCTCCCAGGCACTGG - Intergenic
1045336264 8:101206168-101206190 CACCCAGGACACCGCGGCCCCGG + Intronic
1056637869 9:88346503-88346525 CACTCACGACTTCCCCCCACTGG + Intergenic
1056938859 9:90938002-90938024 CACCCAGGACTTTCCCTCAGAGG - Intergenic
1059338478 9:113583818-113583840 CATCCAGGAATCCCCCACCCGGG + Exonic
1059725670 9:117006050-117006072 GACCCAGGAGTCCCTCACACAGG - Intronic
1060239780 9:121892935-121892957 AGCCCAGAACTCCCCCTCACTGG + Intronic
1060736377 9:126068983-126069005 CACAGTGGACACCCCCGCACTGG - Intergenic
1061130447 9:128705180-128705202 CACCCAGGACTGACTCGCACAGG - Intronic
1061192437 9:129089515-129089537 CACCCAGGCCACCCCGGCCCAGG - Exonic
1061410051 9:130415697-130415719 CCCTCAGGTCTCCCCTGCACAGG + Intronic
1061908035 9:133708744-133708766 ACCCCAGGACTCCCCAGCACTGG - Intronic
1061938569 9:133872037-133872059 CATCCAGGACTCTCAGGCACTGG + Intronic
1185736748 X:2501212-2501234 CAGCCAGGACCCCCCCCCCCAGG + Intronic
1190212392 X:48459010-48459032 CTCCCAGGACTCCAAAGCACAGG + Exonic