ID: 932493708

View in Genome Browser
Species Human (GRCh38)
Location 2:72136462-72136484
Sequence GTTTGCAGAAATAACAGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932493700_932493708 8 Left 932493700 2:72136431-72136453 CCTAGGCCCTGCATGGCTAATGG 0: 1
1: 0
2: 0
3: 7
4: 157
Right 932493708 2:72136462-72136484 GTTTGCAGAAATAACAGTGCTGG 0: 1
1: 0
2: 2
3: 10
4: 180
932493706_932493708 1 Left 932493706 2:72136438-72136460 CCTGCATGGCTAATGGGAGGGCT 0: 1
1: 0
2: 1
3: 13
4: 92
Right 932493708 2:72136462-72136484 GTTTGCAGAAATAACAGTGCTGG 0: 1
1: 0
2: 2
3: 10
4: 180
932493699_932493708 13 Left 932493699 2:72136426-72136448 CCTGGCCTAGGCCCTGCATGGCT 0: 1
1: 0
2: 3
3: 29
4: 299
Right 932493708 2:72136462-72136484 GTTTGCAGAAATAACAGTGCTGG 0: 1
1: 0
2: 2
3: 10
4: 180
932493705_932493708 2 Left 932493705 2:72136437-72136459 CCCTGCATGGCTAATGGGAGGGC 0: 1
1: 0
2: 0
3: 13
4: 110
Right 932493708 2:72136462-72136484 GTTTGCAGAAATAACAGTGCTGG 0: 1
1: 0
2: 2
3: 10
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932493708 Original CRISPR GTTTGCAGAAATAACAGTGC TGG Intronic
901755375 1:11438511-11438533 CTTTGAAGAAAGAACACTGCAGG - Intergenic
902681736 1:18048597-18048619 GTTTGAAGTAATTACTGTGCAGG - Intergenic
904402987 1:30269094-30269116 GTTTGCAGGACTCACAGTGATGG + Intergenic
906722884 1:48022156-48022178 GTTTGGAGAAAAAACAGGCCTGG + Intergenic
907929735 1:58988167-58988189 GTTTGGAGAAATAACAAAACAGG + Intergenic
908533535 1:65056311-65056333 GTCTGAAAAAATAACAGTTCTGG + Intergenic
909211043 1:72824102-72824124 GTTTCCAGAAAAAAATGTGCTGG - Intergenic
913453636 1:119008875-119008897 GTTTTCAGGAATAACATTTCTGG + Intergenic
913569094 1:120102509-120102531 GTATGCAAAAAAAACAGTTCTGG + Intergenic
915833966 1:159158985-159159007 ATTTGTAGAAATAGCACTGCTGG + Intergenic
916347628 1:163811826-163811848 GTTTGCAGAAATGATAATGAAGG + Intergenic
917776121 1:178336843-178336865 TTTTGTAGAAATAAAAGTGTTGG + Intronic
922644294 1:227270375-227270397 GCTTTCAGAAATAAAAGTGGAGG - Intronic
1062982993 10:1741082-1741104 TTTTGCAGAAATAAAAGATCAGG - Intergenic
1064812141 10:19211891-19211913 GTTTGCATAAAGAAAAATGCAGG + Intronic
1067224114 10:44364166-44364188 GTCTGCAGAAGGAGCAGTGCGGG + Intergenic
1068502006 10:57851465-57851487 GTTATCAGAAATAAAACTGCTGG - Intergenic
1068774790 10:60857974-60857996 GTGTGCAGAAATCACATGGCAGG + Intergenic
1070461716 10:76676794-76676816 GTTTCCAGAAATGACAATGGAGG + Intergenic
1070782092 10:79143568-79143590 GTGTGCAGAGATGACAGTGGAGG + Intronic
1071289172 10:84176295-84176317 CTTTTCAGAAATAACAATGTTGG - Intronic
1072353072 10:94577572-94577594 ATTTGCAGAAATCTCAGTTCAGG + Intronic
1079359799 11:19760941-19760963 GTTTGGAAAAATACCAGTGCTGG + Intronic
1079470227 11:20770980-20771002 CTTTCCAGAAACAACTGTGCAGG - Intronic
1079600369 11:22304802-22304824 TTTTGCCCAAATAACAGTGGCGG - Intergenic
1080169816 11:29287223-29287245 CCTTGCAGAAATAACAGTCTTGG + Intergenic
1081075617 11:38669110-38669132 GTTTGTAAGAATACCAGTGCTGG + Intergenic
1081079027 11:38715836-38715858 GTTTGCAGTAATGACATTGTAGG + Intergenic
1082563467 11:54647260-54647282 GTTTGAAGAAATATCCGTTCAGG + Intergenic
1086464042 11:87035700-87035722 AATTACAGAAATAGCAGTGCAGG - Intergenic
1088978363 11:114836357-114836379 GTTTACAGAAATATCAGTCACGG - Intergenic
1089651272 11:119914992-119915014 GTTTGCAAATGTAACTGTGCAGG - Intergenic
1090187329 11:124747007-124747029 GTTTGCATAAACAAGAGAGCTGG - Exonic
1090420080 11:126568591-126568613 GGTTTCAGAACTAACAGAGCTGG + Intronic
1090597138 11:128332326-128332348 GTTTCCAAAAATAAAATTGCTGG + Intergenic
1090693013 11:129204929-129204951 GTTTCCAGAAATAAATGAGCAGG - Intronic
1094436129 12:30422735-30422757 GTTTTCAGAAATAAAAGTGCTGG + Intergenic
1096000315 12:48124279-48124301 GTTTGCAGAAACCACAGATCTGG + Intronic
1096373569 12:51088867-51088889 GTATGCAGAAAAAACAGTGCTGG + Intergenic
1097496145 12:60338140-60338162 GTTTGGAGCAATTACAGTGTTGG - Intergenic
1098448518 12:70592615-70592637 GCTTGCAGAAATAAAATTACAGG - Intronic
1099790305 12:87325779-87325801 AATTACAGAAATAACATTGCTGG - Intergenic
1103121060 12:118379725-118379747 TTCTGCAGAAACAACAATGCTGG - Intronic
1104161501 12:126185723-126185745 GAATGCAGAAGTAACAGTGAAGG + Intergenic
1104452474 12:128881991-128882013 TTTTCCAGAAATAACCTTGCAGG + Intronic
1106435364 13:29718925-29718947 GGTTGCAAAAATAGCAGAGCTGG - Intergenic
1107945554 13:45414989-45415011 CTTTGCAGAAATTCCAGTGTCGG + Intronic
1108256240 13:48613841-48613863 CTTTGCAGAAATATCTGTTCAGG + Intergenic
1108458252 13:50638357-50638379 GTTTTCAGAAATCATAGTGTTGG - Intronic
1109809663 13:67495575-67495597 GTTTTTAGAAATAAAAATGCTGG + Intergenic
1111193547 13:84841208-84841230 GTTTGATGAAATAGCAATGCTGG + Intergenic
1117541836 14:56755043-56755065 ATCTGCTGTAATAACAGTGCTGG + Intergenic
1117737538 14:58782860-58782882 ATTTGAAGAAAGAACATTGCAGG + Intergenic
1118315231 14:64721977-64721999 TTTTCCAGAAAAAACAGTGTGGG - Intronic
1118701584 14:68438885-68438907 ATTTGCAGAAATACCAGTACAGG + Intronic
1120725704 14:87937823-87937845 GTTTGCAAAAATAAAACTGAAGG + Intronic
1124551709 15:30687072-30687094 GTTTGCAGAACTAGCACTTCAGG + Intronic
1124679541 15:31718593-31718615 GTTTGCAGAACTAGCACTTCAGG - Intronic
1125152710 15:36551428-36551450 GTTCGCAGACCTAACAGTGAGGG + Intergenic
1126255047 15:46615524-46615546 GTGTGCAGAAGTAACACTGGAGG - Intergenic
1126564172 15:50077345-50077367 GATTGAAAACATAACAGTGCTGG + Intronic
1130010458 15:80149208-80149230 TTTTGTTGAAATAACAGTGAGGG + Intergenic
1130676968 15:85961404-85961426 GTTGGCAAAAATGAGAGTGCAGG + Intergenic
1134654856 16:15940510-15940532 GTTTGAAAATATATCAGTGCAGG + Intergenic
1135614658 16:23900801-23900823 TTTTGCATAACAAACAGTGCTGG + Intronic
1138753160 16:59448658-59448680 CTTTGCAGAAATATCTGTTCAGG + Intergenic
1139316325 16:66072660-66072682 CTTTACAGAAAGCACAGTGCTGG + Intergenic
1140107348 16:71972840-71972862 GTGTGCAAATATAATAGTGCTGG + Intronic
1142258706 16:89031961-89031983 GTTTGGAGGTAAAACAGTGCTGG - Intergenic
1144869823 17:18362622-18362644 TCTTGCAGAAATAACATTGTAGG - Intronic
1147641553 17:42004723-42004745 TTTTTCAGAAATAACCTTGCTGG + Intronic
1150774242 17:68066338-68066360 GAGTGCAGAAAACACAGTGCAGG + Intergenic
1151140682 17:71989361-71989383 TTTTGCAGAAATAAAAGAACTGG - Intergenic
1153748470 18:8205306-8205328 GTTTGGAGAACTCACATTGCAGG - Intronic
1156483817 18:37452318-37452340 CTGTGCAGAAATGACAGTCCTGG - Intronic
1156793648 18:41011630-41011652 GATTGCAAAAATGACTGTGCTGG + Intergenic
1157087356 18:44594977-44594999 GTTTGCAGAACTAACAGGTTGGG + Intergenic
1157380514 18:47211150-47211172 GTTGGCAAAAAGAACTGTGCAGG - Intergenic
1157897994 18:51486720-51486742 TTTTGCAGAAATAGAAGTTCTGG + Intergenic
1162720586 19:12659889-12659911 TTTTGGTGAAATAGCAGTGCTGG + Intronic
1165252985 19:34555499-34555521 GGTTGCAGAAAGGACACTGCAGG + Intergenic
1167383645 19:49152040-49152062 GATAGCAGAACTGACAGTGCTGG + Exonic
1167831770 19:52028751-52028773 GTTTGAAGAAGTCACGGTGCTGG + Intronic
1168440040 19:56356870-56356892 GTCTGCAGGAATCATAGTGCAGG - Intronic
925564312 2:5233863-5233885 GTTTCCAGAAATAAAACTCCAGG + Intergenic
926168655 2:10536864-10536886 GATTTCAGAACAAACAGTGCTGG + Intergenic
931073469 2:58682593-58682615 TTTTGCAGAAATAATATTGGGGG + Intergenic
931955481 2:67419272-67419294 GTATGTAGAAATCACAGGGCAGG + Intergenic
932493708 2:72136462-72136484 GTTTGCAGAAATAACAGTGCTGG + Intronic
933463973 2:82626550-82626572 GTGTGCAGAAATCACATGGCAGG + Intergenic
933862954 2:86488438-86488460 GCTTGCTGAAATATCAGTCCTGG - Intronic
934705354 2:96473826-96473848 GTTTTCAGAAAAAACTGTTCTGG + Intergenic
935177574 2:100663285-100663307 GATTGCAGAAAAAACAGAGTAGG + Intergenic
940191797 2:151048519-151048541 GTTAGCAGATATAAAACTGCTGG - Intronic
941430118 2:165404109-165404131 GCTTGCAAAAGTAACATTGCTGG + Intergenic
943544755 2:189260936-189260958 GTTTCCAGAAACAAAAGTTCAGG + Intergenic
945801944 2:214444193-214444215 GTTTGTAGAACAAACTGTGCTGG + Intronic
946783912 2:223222242-223222264 GTTTGCAGACATGACAGGGTGGG - Intergenic
948596227 2:239081454-239081476 GTCCGCAGAAATGTCAGTGCAGG - Intronic
1169024818 20:2360948-2360970 GTTTGAAGAAATAACAATCTCGG - Intergenic
1169720066 20:8666594-8666616 GTTTGCAGAAATGGCAATGTTGG + Intronic
1171316798 20:24202522-24202544 GTTTGCATTAATAACAAGGCAGG - Intergenic
1177577144 21:22972612-22972634 GCTTACAGAAATTACAGTGCTGG + Intergenic
1177688933 21:24477888-24477910 TTTTGCAGTAATACCAGTGAAGG - Intergenic
1179527080 21:41986495-41986517 CTATGCAGAAATATCAATGCAGG + Intergenic
1181296374 22:21843033-21843055 TGCTGCAGAAATATCAGTGCTGG - Intronic
1183858823 22:40654217-40654239 GTTTGCAGAAAAAACTGAGGTGG - Intergenic
949838834 3:8298466-8298488 GCTTGCAGAAAGAACACTGGAGG + Intergenic
950998825 3:17533990-17534012 GGTTTCAGAAAATACAGTGCTGG - Intronic
951930617 3:27962962-27962984 ATTTGCAGAAATAAAAATACTGG - Intergenic
953262735 3:41355802-41355824 GTTTGAAGAAATGACAGGGTAGG + Intronic
956218940 3:66881673-66881695 GATTGCAGAACTAATAATGCAGG + Intergenic
956768335 3:72503433-72503455 GTTTGCAGAAATAAAAGACAAGG + Intergenic
958650867 3:96934433-96934455 GTATGCAGAAAAAATAGTTCTGG - Intronic
959063881 3:101638443-101638465 GGTTGCAGAAAGGACACTGCAGG - Intergenic
959258117 3:104040661-104040683 CTTTGCAGAAAGAACCTTGCTGG + Intergenic
966179519 3:177175502-177175524 GTTTTAAGAAAAACCAGTGCAGG + Intronic
966310152 3:178585123-178585145 GTTTGCAGAAATCCAAGTGAAGG - Intronic
966387962 3:179421899-179421921 GTTTCCAGAAATGACAGTGATGG + Intronic
974066552 4:57083162-57083184 GTTTCCAGAAATAAGATTGCTGG + Intronic
975337728 4:73199789-73199811 GTTTGAACCAAGAACAGTGCAGG + Intronic
975669532 4:76767056-76767078 GTTTTCAGAGACATCAGTGCTGG - Intronic
976091931 4:81467615-81467637 CTTTGTAGCAGTAACAGTGCTGG + Intronic
977566757 4:98588072-98588094 GTTTGCAGAATAGACTGTGCAGG - Intronic
977975555 4:103261467-103261489 CTTTGCAGTAATAACATTGAAGG + Intergenic
978383451 4:108155421-108155443 GTTTGCATAAATAAAAATTCAGG - Intronic
979740128 4:124139266-124139288 GTACTTAGAAATAACAGTGCTGG + Intergenic
979808950 4:125011748-125011770 CTCTGCAGGAATAACAGGGCAGG + Intergenic
981485353 4:145280498-145280520 ATTTGCAGAAATAAAATTGTTGG + Intergenic
982105227 4:152005909-152005931 TTTTGCAGAATTAAGAGTTCTGG - Intergenic
982981214 4:162138242-162138264 TTTTGGAGAAATTACAGTGATGG + Intronic
986006628 5:3673735-3673757 GTGTGCAAAAATCACAGAGCTGG - Intergenic
987411540 5:17619935-17619957 GTTGGCAGAATTACCAGTGTGGG - Intergenic
987647854 5:20698948-20698970 GTATCTAGAAATAAGAGTGCTGG + Intergenic
988748483 5:34169912-34169934 GTATCTAGAAATAAGAGTGCTGG - Intergenic
993199739 5:84799843-84799865 ATTTACATAAATGACAGTGCTGG - Intergenic
994465840 5:100129408-100129430 GTTTGGAGAAATAACTCTGTGGG - Intergenic
995174344 5:109157412-109157434 GTTTACAAAAATGACAGTCCAGG - Intronic
995865389 5:116684869-116684891 GTTTGCTCATATCACAGTGCGGG + Intergenic
1000623015 5:163506144-163506166 CTTCTCACAAATAACAGTGCTGG + Intronic
1001696885 5:173676843-173676865 GTTAGCAGAGATAAAAGTGGAGG + Intergenic
1002766019 6:239656-239678 TTCAGCAGAAATAAAAGTGCTGG - Intergenic
1004331310 6:14724164-14724186 GTTTGCAAAAATAAAAGTTATGG - Intergenic
1004997211 6:21205312-21205334 TTGTGCAGAAATAAGATTGCTGG + Intronic
1005546059 6:26873009-26873031 GTATCTAGAAATAAGAGTGCTGG - Intergenic
1007717695 6:43866708-43866730 CTTTGCAGCAATAAGAGGGCTGG + Intergenic
1008618839 6:53252075-53252097 GTTTGGAGAAATAAGAGAGGAGG - Intergenic
1009016767 6:57913801-57913823 GTATCTAGAAATAAGAGTGCTGG - Intergenic
1010481171 6:76356001-76356023 GTTTGCAGAAATAGCCATGCAGG + Intergenic
1012110767 6:95229397-95229419 GTTTGAAGAACTTACAGTGCGGG + Intergenic
1013497097 6:110708351-110708373 GTTAGCAGAAATCACTGTGGAGG - Intronic
1015560437 6:134509591-134509613 GTTTGCAGAAATATCTGAGAAGG - Intergenic
1015980588 6:138834286-138834308 GTTTGTAGTAATGACATTGCAGG - Intronic
1016182973 6:141169826-141169848 ATTAGCAAAAATCACAGTGCTGG - Intergenic
1020757866 7:12226303-12226325 GTTTGCAAAAAGAACAAAGCTGG - Intronic
1027581653 7:80004493-80004515 ATCTGCAGAAATAACATTCCTGG + Intergenic
1027755514 7:82206156-82206178 GATTTCAGAAATAATAGTTCAGG - Intronic
1030663983 7:112253675-112253697 AGTGGCAGAAATAACATTGCAGG - Intronic
1030963218 7:115953160-115953182 GGGTGCAGAAAGAACAGTGGGGG + Intronic
1031308629 7:120165208-120165230 GTTGGTAGAAATAACAGTAAAGG - Intergenic
1032487876 7:132301621-132301643 GTTTACATAAACAATAGTGCCGG - Intronic
1033895937 7:146070149-146070171 GTTTGCACAAATAAATATGCAGG - Intergenic
1034298744 7:149996555-149996577 GTTTGTAAAAATAGCAGTTCTGG + Intergenic
1034807273 7:154100226-154100248 GTTTGTAAAAATAGCAGTTCTGG - Intronic
1036635993 8:10549784-10549806 GTTTAGAGAAATGACAGAGCGGG - Intronic
1041979457 8:63840111-63840133 GTTTGCTGAAAAACTAGTGCTGG + Intergenic
1042625477 8:70751875-70751897 GTTTGCAGACATAATATTGTGGG + Intronic
1042817539 8:72894180-72894202 GTGTGCAGGAAGAACATTGCAGG + Intronic
1043079638 8:75749956-75749978 GCCTGAAGAAATTACAGTGCTGG + Intergenic
1045304368 8:100945460-100945482 CTTTGCAGAAATAATAGTATTGG - Intronic
1047536250 8:125722586-125722608 GTTTGCAGAAATACAATAGCGGG - Intergenic
1048529142 8:135231835-135231857 GTTTGGATGAATAATAGTGCAGG + Intergenic
1048854550 8:138675145-138675167 GTGGGTAGAAATAACAGTGAGGG + Intronic
1052796360 9:32927117-32927139 GTTTGAGGAAATGACTGTGCTGG - Intergenic
1053053032 9:34977190-34977212 GTTTGCAAAACCAAGAGTGCTGG - Exonic
1053382548 9:37660713-37660735 CCTTGCAGAAATGAAAGTGCAGG - Intronic
1055690427 9:78824185-78824207 GTTTGCAGTAACCACATTGCTGG + Intergenic
1057933159 9:99213330-99213352 GTTTGAAAAAATAACAGAGAAGG - Intergenic
1059545185 9:115168689-115168711 CTTTGCAGAAATATCAGGTCAGG + Intronic
1060359016 9:122937298-122937320 GTTCGAAGAACTAACAGGGCTGG + Intergenic
1060398694 9:123334511-123334533 GTTTGCAGAAATAGCAGGGGTGG + Intergenic
1061723829 9:132570562-132570584 GCTTACATAAAAAACAGTGCAGG - Intronic
1061842767 9:133369205-133369227 GTGTGCAGAACTGACACTGCAGG - Intronic
1062078027 9:134602703-134602725 GTTTGCAGAAATTCCACTGCCGG - Intergenic
1187767911 X:22663808-22663830 GTTTACAGAAAGCATAGTGCTGG + Intergenic
1189023212 X:37364121-37364143 CTTTGGAGAAATCACAGTCCTGG + Intronic
1189311578 X:40022346-40022368 GTTTCCGGCAATAACAGTGATGG + Intergenic
1191865108 X:65697618-65697640 TTTAGCAGAAATACCAATGCTGG + Intronic
1193282997 X:79677313-79677335 GCATACAGAAATAACAGTGTGGG + Intergenic
1195386339 X:104316933-104316955 GGAAGCAGAAATAACAGTGCAGG - Intergenic
1195415805 X:104618585-104618607 CTTTGCAGAAATATTGGTGCAGG - Intronic
1199589479 X:149453377-149453399 GTTTGCATTAATAACAGTATGGG - Intergenic
1201276216 Y:12301208-12301230 GTTTGCGTAAACAATAGTGCAGG - Intergenic