ID: 932496748

View in Genome Browser
Species Human (GRCh38)
Location 2:72149384-72149406
Sequence ACTGCTCGGAGCTGGAGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496748_932496761 8 Left 932496748 2:72149384-72149406 CCCCTCCTCCAGCTCCGAGCAGT No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496748_932496760 5 Left 932496748 2:72149384-72149406 CCCCTCCTCCAGCTCCGAGCAGT No data
Right 932496760 2:72149412-72149434 CTGGGCCGAAGCCCCGGCAGCGG No data
932496748_932496756 -1 Left 932496748 2:72149384-72149406 CCCCTCCTCCAGCTCCGAGCAGT No data
Right 932496756 2:72149406-72149428 TCCCTCCTGGGCCGAAGCCCCGG No data
932496748_932496763 14 Left 932496748 2:72149384-72149406 CCCCTCCTCCAGCTCCGAGCAGT No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496748_932496767 18 Left 932496748 2:72149384-72149406 CCCCTCCTCCAGCTCCGAGCAGT No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496748 Original CRISPR ACTGCTCGGAGCTGGAGGAG GGG (reversed) Intergenic