ID: 932496751

View in Genome Browser
Species Human (GRCh38)
Location 2:72149389-72149411
Sequence GAGGGACTGCTCGGAGCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496751_932496760 0 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496760 2:72149412-72149434 CTGGGCCGAAGCCCCGGCAGCGG No data
932496751_932496767 13 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496751_932496763 9 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496751_932496756 -6 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496756 2:72149406-72149428 TCCCTCCTGGGCCGAAGCCCCGG No data
932496751_932496769 30 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496751_932496761 3 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496751 Original CRISPR GAGGGACTGCTCGGAGCTGG AGG (reversed) Intergenic