ID: 932496752

View in Genome Browser
Species Human (GRCh38)
Location 2:72149392-72149414
Sequence CAGGAGGGACTGCTCGGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496752_932496756 -9 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496756 2:72149406-72149428 TCCCTCCTGGGCCGAAGCCCCGG No data
932496752_932496763 6 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496752_932496761 0 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496752_932496769 27 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496752_932496760 -3 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496760 2:72149412-72149434 CTGGGCCGAAGCCCCGGCAGCGG No data
932496752_932496767 10 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496752 Original CRISPR CAGGAGGGACTGCTCGGAGC TGG (reversed) Intergenic