ID: 932496755

View in Genome Browser
Species Human (GRCh38)
Location 2:72149398-72149420
Sequence TCGGCCCAGGAGGGACTGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496755_932496769 21 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496755_932496761 -6 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496755_932496763 0 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496755_932496771 25 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496755_932496767 4 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496755_932496760 -9 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496760 2:72149412-72149434 CTGGGCCGAAGCCCCGGCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496755 Original CRISPR TCGGCCCAGGAGGGACTGCT CGG (reversed) Intergenic