ID: 932496757

View in Genome Browser
Species Human (GRCh38)
Location 2:72149407-72149429
Sequence GCCGGGGCTTCGGCCCAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496757_932496771 16 Left 932496757 2:72149407-72149429 CCCTCCTGGGCCGAAGCCCCGGC No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496757_932496769 12 Left 932496757 2:72149407-72149429 CCCTCCTGGGCCGAAGCCCCGGC No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496757_932496767 -5 Left 932496757 2:72149407-72149429 CCCTCCTGGGCCGAAGCCCCGGC No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data
932496757_932496763 -9 Left 932496757 2:72149407-72149429 CCCTCCTGGGCCGAAGCCCCGGC No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496757 Original CRISPR GCCGGGGCTTCGGCCCAGGA GGG (reversed) Intergenic