ID: 932496758

View in Genome Browser
Species Human (GRCh38)
Location 2:72149408-72149430
Sequence TGCCGGGGCTTCGGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496758_932496763 -10 Left 932496758 2:72149408-72149430 CCTCCTGGGCCGAAGCCCCGGCA No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496758_932496771 15 Left 932496758 2:72149408-72149430 CCTCCTGGGCCGAAGCCCCGGCA No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496758_932496769 11 Left 932496758 2:72149408-72149430 CCTCCTGGGCCGAAGCCCCGGCA No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496758_932496767 -6 Left 932496758 2:72149408-72149430 CCTCCTGGGCCGAAGCCCCGGCA No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496758 Original CRISPR TGCCGGGGCTTCGGCCCAGG AGG (reversed) Intergenic