ID: 932496759

View in Genome Browser
Species Human (GRCh38)
Location 2:72149411-72149433
Sequence CGCTGCCGGGGCTTCGGCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496759_932496769 8 Left 932496759 2:72149411-72149433 CCTGGGCCGAAGCCCCGGCAGCG No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data
932496759_932496771 12 Left 932496759 2:72149411-72149433 CCTGGGCCGAAGCCCCGGCAGCG No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496759_932496767 -9 Left 932496759 2:72149411-72149433 CCTGGGCCGAAGCCCCGGCAGCG No data
Right 932496767 2:72149425-72149447 CCGGCAGCGGAGGTCCTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496759 Original CRISPR CGCTGCCGGGGCTTCGGCCC AGG (reversed) Intergenic