ID: 932496761

View in Genome Browser
Species Human (GRCh38)
Location 2:72149415-72149437
Sequence GGCCGAAGCCCCGGCAGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496751_932496761 3 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496750_932496761 6 Left 932496750 2:72149386-72149408 CCTCCTCCAGCTCCGAGCAGTCC No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496745_932496761 26 Left 932496745 2:72149366-72149388 CCTTCCCAGGTCAGCGGTCCCCT No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496752_932496761 0 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496744_932496761 29 Left 932496744 2:72149363-72149385 CCTCCTTCCCAGGTCAGCGGTCC No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496749_932496761 7 Left 932496749 2:72149385-72149407 CCCTCCTCCAGCTCCGAGCAGTC No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496748_932496761 8 Left 932496748 2:72149384-72149406 CCCCTCCTCCAGCTCCGAGCAGT No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496747_932496761 21 Left 932496747 2:72149371-72149393 CCAGGTCAGCGGTCCCCTCCTCC No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496746_932496761 22 Left 932496746 2:72149370-72149392 CCCAGGTCAGCGGTCCCCTCCTC No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data
932496755_932496761 -6 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496761 2:72149415-72149437 GGCCGAAGCCCCGGCAGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496761 Original CRISPR GGCCGAAGCCCCGGCAGCGG AGG Intergenic