ID: 932496762

View in Genome Browser
Species Human (GRCh38)
Location 2:72149417-72149439
Sequence GACCTCCGCTGCCGGGGCTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496762_932496771 6 Left 932496762 2:72149417-72149439 CCGAAGCCCCGGCAGCGGAGGTC No data
Right 932496771 2:72149446-72149468 GGACTGCCCCCTCGACTGGCAGG No data
932496762_932496769 2 Left 932496762 2:72149417-72149439 CCGAAGCCCCGGCAGCGGAGGTC No data
Right 932496769 2:72149442-72149464 GGCCGGACTGCCCCCTCGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496762 Original CRISPR GACCTCCGCTGCCGGGGCTT CGG (reversed) Intergenic