ID: 932496762 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:72149417-72149439 |
| Sequence | GACCTCCGCTGCCGGGGCTT CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 932496762_932496769 | 2 | Left | 932496762 | 2:72149417-72149439 | CCGAAGCCCCGGCAGCGGAGGTC | No data | ||
| Right | 932496769 | 2:72149442-72149464 | GGCCGGACTGCCCCCTCGACTGG | No data | ||||
| 932496762_932496771 | 6 | Left | 932496762 | 2:72149417-72149439 | CCGAAGCCCCGGCAGCGGAGGTC | No data | ||
| Right | 932496771 | 2:72149446-72149468 | GGACTGCCCCCTCGACTGGCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 932496762 | Original CRISPR | GACCTCCGCTGCCGGGGCTT CGG (reversed) | Intergenic | ||