ID: 932496763

View in Genome Browser
Species Human (GRCh38)
Location 2:72149421-72149443
Sequence AGCCCCGGCAGCGGAGGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
932496751_932496763 9 Left 932496751 2:72149389-72149411 CCTCCAGCTCCGAGCAGTCCCTC No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496757_932496763 -9 Left 932496757 2:72149407-72149429 CCCTCCTGGGCCGAAGCCCCGGC No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496746_932496763 28 Left 932496746 2:72149370-72149392 CCCAGGTCAGCGGTCCCCTCCTC No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496752_932496763 6 Left 932496752 2:72149392-72149414 CCAGCTCCGAGCAGTCCCTCCTG No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496749_932496763 13 Left 932496749 2:72149385-72149407 CCCTCCTCCAGCTCCGAGCAGTC No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496748_932496763 14 Left 932496748 2:72149384-72149406 CCCCTCCTCCAGCTCCGAGCAGT No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496755_932496763 0 Left 932496755 2:72149398-72149420 CCGAGCAGTCCCTCCTGGGCCGA No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496750_932496763 12 Left 932496750 2:72149386-72149408 CCTCCTCCAGCTCCGAGCAGTCC No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496758_932496763 -10 Left 932496758 2:72149408-72149430 CCTCCTGGGCCGAAGCCCCGGCA No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data
932496747_932496763 27 Left 932496747 2:72149371-72149393 CCAGGTCAGCGGTCCCCTCCTCC No data
Right 932496763 2:72149421-72149443 AGCCCCGGCAGCGGAGGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
932496763 Original CRISPR AGCCCCGGCAGCGGAGGTCC TGG Intergenic